View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1713_low_1 (Length: 269)
Name: NF1713_low_1
Description: NF1713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1713_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 15 - 258
Target Start/End: Complemental strand, 7607739 - 7607496
Alignment:
| Q |
15 |
cttttcaccataatcaaaatatgtaaagattagggtgttgcaaattttgagacataaatgaagtagcatataatattatgccgaattccgttgacannnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7607739 |
cttttcaccataatcaaaatatgtaaagattagggtgttgcaaattttgagacacaaatgaagtagcatataatattatgccgaattccgttgacatttt |
7607640 |
T |
 |
| Q |
115 |
nnnatgttcatatagttttcttatcctttgacacattggatagaatttgataaattttaagctaaacattttatgtgctccatacttgttcaaactttca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7607639 |
tttatgttcatatagttttcttatcctttgacacattggatagaatttgataaattttaagctaaccattttatgtgctccatacttgttcaaactttca |
7607540 |
T |
 |
| Q |
215 |
taggcttatgctgtattatgttccatgtttttatagtttttctt |
258 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7607539 |
taggcttaagctgtattatgttccatgtttttttagtttttctt |
7607496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University