View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1713_low_12 (Length: 208)
Name: NF1713_low_12
Description: NF1713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1713_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 15 - 126
Target Start/End: Complemental strand, 2733900 - 2733789
Alignment:
| Q |
15 |
atcaatcatgttacgaagattactcatctcttcacaactcaaaaccctaacttctcgccgatctccttcctccgccgtcgctgtttccttactctcccgc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2733900 |
atcaatcatgttacgaagattactcatctcttcacaactcaaaaccctaacttctcgccgatctccttcctccgccgttgctgtttccttactctcccgc |
2733801 |
T |
|
| Q |
115 |
caccacttctct |
126 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2733800 |
caccacttctct |
2733789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University