View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17140_low_14 (Length: 306)
Name: NF17140_low_14
Description: NF17140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17140_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 14 - 288
Target Start/End: Original strand, 5052901 - 5053175
Alignment:
| Q |
14 |
caaaggggataattcaagttgctagcataatttcaagcatctctccccttgagaaagagtgggaggtaaatgtttacattgataattgaatcattaaaag |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5052901 |
caaaggggataattcaagttgctagcataatttcaagcatctctcaccttaagaaagagtgggaggtaaatgtttacattgataattgaatcattaaaag |
5053000 |
T |
|
| Q |
114 |
ttaaaacacttaataaatcatgcaaaacttcatttcttatgcatcgaatagagatatcaacacaagcataaaaaagaattaatttattataggcatgcag |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5053001 |
ttaaaacacttaataaatcatgcaaaacttcatttcttatgcatcgaatagagatatcaacacaagcataaaaaagaattaatttattataggcatgcag |
5053100 |
T |
|
| Q |
214 |
tgcaagacataatcaaacaaagagacagctcatgcacaaacatgtcagataacaacacttaaaagaatccaaatt |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5053101 |
tgcaagacataatcaaacaaagagacagctcatgcacaaacatgtcagataacaacactcaaaagaatccaaatt |
5053175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University