View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17140_low_19 (Length: 249)
Name: NF17140_low_19
Description: NF17140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17140_low_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 235
Target Start/End: Original strand, 43078005 - 43078229
Alignment:
| Q |
11 |
atcatcattcccaaaggatggtacaattggggtgatcccaaccgtgaaatgtaagtttttccattctcattctcatcttcttatgtattctcttaaatta |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
43078005 |
atcatcattcccaaaggatggtacaattggggtgatcccaaccgtgaaatgtaagtttttc-attctcattctcatcttcttatgtattctcttatatta |
43078103 |
T |
 |
| Q |
111 |
attaaa-tatgtttgctaaaatcaataacctggttgctttagtaccaacttttccaagtgacatacgcacaaactttgagactcagcagcatccatcatc |
209 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43078104 |
attaaaatatgtttgctaaaatcaataacctggttgctttactaccaacttttccaagtgacatacgcacaaactttgagactcagcagcatccatcatc |
43078203 |
T |
 |
| Q |
210 |
atactagaaatgtgagtaaaaaatgt |
235 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
43078204 |
atactagaaatgtgagtaaaaaatgt |
43078229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 11 - 63
Target Start/End: Complemental strand, 33964083 - 33964031
Alignment:
| Q |
11 |
atcatcattcccaaaggatggtacaattggggtgatcccaaccgtgaaatgta |
63 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||||||||| |||||||||||||| |
|
|
| T |
33964083 |
atcatcattcctaaagggtggtataattggggtgatcctaaccgtgaaatgta |
33964031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University