View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17140_low_20 (Length: 244)
Name: NF17140_low_20
Description: NF17140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17140_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 23 - 236
Target Start/End: Complemental strand, 29211465 - 29211240
Alignment:
| Q |
23 |
gctagaatatcttagnnnnnnncggagatagtggtattttttatttgaaactaataatcactatgttcatctagatctagaatagactcttacatgatct |
122 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
29211465 |
gctagaatatcttagaaaaaaacggagatagtagtattttttatttgaaactaataatcactatgttcatctagatctagaatagactcttgcatgatct |
29211366 |
T |
|
| Q |
123 |
tnnnnnnnnn------------tgtttaccacgtataggacatgcaatttcatgttgagtttgaaaatacaatttattttcaaataaaatcaattatacg |
210 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29211365 |
tataacatatcttaaaaaaaaatgtttaccacgtataggacatgcaatttcatgttgagtttgaaaatactttttattttcaaataaaatcaattatacg |
29211266 |
T |
|
| Q |
211 |
aaaataaagaaatgcttgcttcatct |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
29211265 |
aaaataaagaaatgcttgcttcatct |
29211240 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University