View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17140_low_23 (Length: 227)
Name: NF17140_low_23
Description: NF17140
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17140_low_23 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 44769369 - 44769141
Alignment:
| Q |
1 |
cggtatcaggagttgacatagataacactacgaaatgaatcccttttaacttgtgagtcaggacaacacgaaggaaaaaa--tcaacattcacaaactaa |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
44769369 |
cggtatcaggagttgacatagataacactacgaaatgaatcccttttaacttgtgagtcaggacaacacgaaggaaaaaaaatcaacattcacaaactaa |
44769270 |
T |
 |
| Q |
99 |
gacttttgtgcctgaagttcaggtcaaggttgccaagaaagtgaacttaattctactattgatataagaatattctgaaacaatgaaaagaatcattata |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44769269 |
gacttttgtgcctgaagttcaggtcaaggttgccaagaaagtgaacttaattctactattgatataagaatattctgaaacaatgaaaagaatcattata |
44769170 |
T |
 |
| Q |
199 |
atagcaaaactaaacactcgtattgatga |
227 |
Q |
| |
|
|||||||||||||||||||||||| |||| |
|
|
| T |
44769169 |
atagcaaaactaaacactcgtattcatga |
44769141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 107 - 151
Target Start/End: Complemental strand, 44760089 - 44760045
Alignment:
| Q |
107 |
tgcctgaagttcaggtcaaggttgccaagaaagtgaacttaattc |
151 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||| |||||||| |
|
|
| T |
44760089 |
tgcctgaagttcaggtcaaggttgtcaagaacgtgaccttaattc |
44760045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 66
Target Start/End: Complemental strand, 25080750 - 25080708
Alignment:
| Q |
24 |
aacactacgaaatgaatcccttttaacttgtgagtcaggacaa |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25080750 |
aacactacgaaatgaatcccttttaacttgtcagtcaggacaa |
25080708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 24 - 66
Target Start/End: Complemental strand, 25138719 - 25138677
Alignment:
| Q |
24 |
aacactacgaaatgaatcccttttaacttgtgagtcaggacaa |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
25138719 |
aacactacgaaatgaatcccttttaacttgtcagtcaggacaa |
25138677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University