View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17141_high_13 (Length: 222)
Name: NF17141_high_13
Description: NF17141
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17141_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 205
Target Start/End: Complemental strand, 28469831 - 28469636
Alignment:
| Q |
17 |
gaagtgaatgatttggatactttcgatcgattcaaaattaacggatactcatttatctaaccacttgagtaatgtaatgagttt------ctttctttgt |
110 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28469831 |
gaagtgaataatttggatagtttcgatcgattcaaaatta-cggatactcatttatctaaccacttgagtaatgtaatgagtttgagtttctttctttgt |
28469733 |
T |
|
| Q |
111 |
gagacgatatt-----tgttggtgtttttggatgctacattcttaactaatgttgctgatataataaataaatgtaagaaggatataaatatttctttac |
205 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28469732 |
gagacgatattggttttgttggtgtttttggatgctacattcttaactaatgttgctgat---ataaataaatgtaagaaggatataaatatttctttac |
28469636 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University