View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17142_low_4 (Length: 239)
Name: NF17142_low_4
Description: NF17142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17142_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 30 - 219
Target Start/End: Complemental strand, 1431943 - 1431754
Alignment:
| Q |
30 |
ttcaataaggtttttccaataatcgatggtttcaatatgagggtatgatcaacatgcataaattgatcatcgtagtagtacatatgtaatcagaatcgat |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1431943 |
ttcaataaggtttttccaataatcgatggtttcaatatgagggtatgatcaacatgcataaattgatcatcgtagtagtacatatgtaatcagaatcgat |
1431844 |
T |
 |
| Q |
130 |
tctaacgcaattgattaaaggattgcagaaagagatattnnnnnnnctcgatagcttgatgagaagaaagaaactcgattgtggcggcga |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1431843 |
tctaacgcaattgattaaaggattgcagaaagagatattaaaaaaactcgatagcttgatgagaagaaagaaactcgattgtggcggcga |
1431754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University