View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17143_low_7 (Length: 237)
Name: NF17143_low_7
Description: NF17143
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17143_low_7 |
 | |
|
| [»] scaffold0275 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0275 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 5 - 237
Target Start/End: Complemental strand, 21592 - 21360
Alignment:
| Q |
5 |
caagattatgggccctttgaaattcttttgatacacgcttagtttctatgtgcatattttatttatttaatatatcaatctctaaacatgcaggttatgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21592 |
caagattatgggccctttgaaattcttttgatacacgcttagtttctatgtgcatattttatttatttaatatatcaatctctaaacatgcaggttatgg |
21493 |
T |
|
| Q |
105 |
ttgacccagccaagaaaaagttatggattgatttctataatgcctttgaaaagacctggtgggctccagacgaggttaaggctttagatgagttgaaggt |
204 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21492 |
ttgacccggccaagaaaaagttatggattgctttctataatgcctttgaaaagatctggtgggctccagacgaggttaaggctttagatgagttgaaggt |
21393 |
T |
|
| Q |
205 |
tgctgttgtggctgcctttcaggagactcaaaa |
237 |
Q |
| |
|
||||| ||||||||||||||| ||| ||||||| |
|
|
| T |
21392 |
tgctgctgtggctgcctttcaagaggctcaaaa |
21360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 21 - 225
Target Start/End: Original strand, 5018969 - 5019173
Alignment:
| Q |
21 |
ttgaaattcttttgatacacgcttagtttctatgtgcatattttatttatttaatatatcaatctctaaacatgcaggttatggttgacccagccaagaa |
120 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
5018969 |
ttgaaattctcttgatacacgcttagtttctatgtgcatatttgatttctttaatatatcaatctctaaacatgcaggttatggtggacccggccaagaa |
5019068 |
T |
|
| Q |
121 |
aaagttatggattgatttctataatgcctttgaaaagacctggtgggctccagacgaggttaaggctttagatgagttgaaggttgctgttgtggctgcc |
220 |
Q |
| |
|
|||||||||| ||| |||| || ||||||| || | || || |||||||| | |||||| |||||||| |||||||||||||||||| |||||||| |
|
|
| T |
5019069 |
aaagttatggtttgctttcgctactgcctttacaatggcccggagggctccaaaagaggttttagctttagacgagttgaaggttgctgttctggctgcc |
5019168 |
T |
|
| Q |
221 |
tttca |
225 |
Q |
| |
|
||||| |
|
|
| T |
5019169 |
tttca |
5019173 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 45 - 91
Target Start/End: Original strand, 4382929 - 4382975
Alignment:
| Q |
45 |
agtttctatgtgcatattttatttatttaatatatcaatctctaaac |
91 |
Q |
| |
|
||||||||||||||||||| | || ||||||| |||||||||||||| |
|
|
| T |
4382929 |
agtttctatgtgcatatttgaattctttaatacatcaatctctaaac |
4382975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University