View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17144_high_10 (Length: 307)
Name: NF17144_high_10
Description: NF17144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17144_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 91; Significance: 4e-44; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 129 - 303
Target Start/End: Complemental strand, 32691303 - 32691129
Alignment:
| Q |
129 |
gaactttgaattttgattgtattgatacggtgttaatttttattgcagacgacaatgggttagagaagaagacttggcaaaggacctcaaattgcatacg |
228 |
Q |
| |
|
|||||||| ||||||||||||||| | | ||||||||| |||| |||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32691303 |
gaactttggattttgattgtattggtctgctgttaatttgtattccagaaaacaatgggttagagaagaagacttggcaaaggacctcaaattgaataca |
32691204 |
T |
|
| Q |
229 |
aagcaacttcgtcgaactctgcggttttttgaagaagaaaagattatcactagagatcataggagagaggtaact |
303 |
Q |
| |
|
||| |||||||||||| |||| || |||| ||||||||||||||||||| ||||||| |||| |||||||||| |
|
|
| T |
32691203 |
aaggaacttcgtcgaaggctgcagtcctttgcagaagaaaagattatcactcgagatcaaaggaaagaggtaact |
32691129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 9 - 91
Target Start/End: Complemental strand, 32692168 - 32692086
Alignment:
| Q |
9 |
agcaaaggagataatcagcccaaaactggaagaagtgataacagaggaattgccgtagtagttcttgatgcgctcaccaggtg |
91 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||| | |||||||| ||||||||||| |
|
|
| T |
32692168 |
agcaaaggagatgatcagcccaaaactggaagaagtgataacagaggaattgacgtagtcatccttgatgccctcaccaggtg |
32692086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University