View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17144_high_12 (Length: 283)
Name: NF17144_high_12
Description: NF17144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17144_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 7 - 268
Target Start/End: Complemental strand, 37959334 - 37959076
Alignment:
| Q |
7 |
ggatgaactcacaaagatactccaatgtaagaggagttatggaagggaagtgatacctatcttctatgaggtggatccgtcagatgttaggcatcagaga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37959334 |
ggatgaactcacaaagatactccaatgtaagaggagttatggaagggaagtgatacctatcttctatgaggtggatccgtcagatgttaggcatcagaga |
37959235 |
T |
|
| Q |
107 |
aatagttatcaagaagattttgtgaagcatcagcaacgatattccaaggacaaaatagatgcgtggaaagctgccttattccaggttgctgggctctcag |
206 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37959234 |
aatagttatcaagaagattttatgaagcatcagcaacga---tccaaggacaaaatagatgcatggaaagctgccctattccaggttgctgggctctcag |
37959138 |
T |
|
| Q |
207 |
gcttgcattcacaaaatatcaggtcactaatttatttacacgttcttgccattattcctcaa |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37959137 |
gcttgcattcacaaaatatcaggtcactaatttatttacacgttcttgccattattcctcaa |
37959076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 7 - 148
Target Start/End: Original strand, 37928026 - 37928167
Alignment:
| Q |
7 |
ggatgaactcacaaagatactccaatgtaagaggagttatggaagggaagtgatacctatcttctatgaggtggatccgtcagatgttaggcatcagaga |
106 |
Q |
| |
|
||||||| ||||||||||||| |||||||| ||| ||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
37928026 |
ggatgaattcacaaagatactggaatgtaaggagagatatggaagggaagtgatacctgtcttctataaggtggatccgtcaactgttaggcatcagaga |
37928125 |
T |
|
| Q |
107 |
aatagttatcaagaagattttgtgaagcatcagcaacgatat |
148 |
Q |
| |
|
| || ||| |||| |||||| |||||||| ||||||||| |
|
|
| T |
37928126 |
gagagctatgccgaagcttttgttaagcatcaacaacgatat |
37928167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University