View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17144_high_16 (Length: 237)
Name: NF17144_high_16
Description: NF17144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17144_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 31945147 - 31944927
Alignment:
| Q |
1 |
gcaatcttttcttcaaatttcacttgctttgtcaatattggagctaaaccaagttgtgaaaatgcatcaaaaccatctaagtttttagaattgccttgaa |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31945147 |
gcaatcttttcttcaaatttgacttgctttgttaatattggagctaaaccaagttgtgaaaatgcatcaaaaccatctaagtttttagaattgccttgaa |
31945048 |
T |
|
| Q |
101 |
aagattcattgttcatgtctatgatgatatcattagttgaagagctaactctacaactacagttaagcaaatcaggaacagaaaagctatcacaaaattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31945047 |
aagattcattgttcatgtctatgatgatatcattagttgaagagctaactctacaactacagttaaccaaatcaggaacagaaaagctatcacaaaattc |
31944948 |
T |
|
| Q |
201 |
agattcagaagaaacacattg |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
31944947 |
agattcagaagaaacacattg |
31944927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University