View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17144_low_17 (Length: 237)
Name: NF17144_low_17
Description: NF17144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17144_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 16 - 220
Target Start/End: Complemental strand, 5685259 - 5685055
Alignment:
| Q |
16 |
cagagaacacaaataaaatactattattaaatttcctaatacatcttgtataatatataatagcatatgctaaagagaaagaattgatattatgataaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5685259 |
cagagaacacaaataaaatactattattaaatttcctaatacatcttgtataatatataatagcatatgctaaagagaaacaattgatattatgataaag |
5685160 |
T |
|
| Q |
116 |
tgtgtcatgggaaatacctttagaatattagggtcaataatattgggacctctactagagaagatggccatagagggtgctggtttggtatctaacacag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5685159 |
tgtgtcatgggaaatacctttagaatattagggtcaataatattgggacctctactagagaagatggccatagagggtgctggtttggtatctaacacag |
5685060 |
T |
|
| Q |
216 |
ttctt |
220 |
Q |
| |
|
||||| |
|
|
| T |
5685059 |
ttctt |
5685055 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 131 - 220
Target Start/End: Complemental strand, 5697314 - 5697225
Alignment:
| Q |
131 |
acctttagaatattagggtcaataatattgggacctctactagagaagatggccatagagggtgctggtttggtatctaacacagttctt |
220 |
Q |
| |
|
||||||||||||||||||||||| || ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697314 |
acctttagaatattagggtcaattatgttgggacctctgctagagaacatggccatagagggtgctggtttggtatctaacacagttctt |
5697225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University