View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17144_low_20 (Length: 219)
Name: NF17144_low_20
Description: NF17144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17144_low_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 13 - 202
Target Start/End: Complemental strand, 5697414 - 5697225
Alignment:
| Q |
13 |
cagagagtacaaacaaattgatgtaaaatttacacatatatcttttataatataatatcttattataaagtgaaacaattaatattgtgaaaaaggaatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697414 |
cagagagtacaaacaaattgatgtaaaatttacacatatatcttttataatataatatcttattataaagtgaaacaattaatattgtgaaaaaggaatc |
5697315 |
T |
 |
| Q |
113 |
acctttagaatattagggtaaattatgttgggacctctgctagagaacatggccatagagggtgctggtttggtatctaacacagttctt |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5697314 |
acctttagaatattagggtcaattatgttgggacctctgctagagaacatggccatagagggtgctggtttggtatctaacacagttctt |
5697225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 113 - 202
Target Start/End: Complemental strand, 5685144 - 5685055
Alignment:
| Q |
113 |
acctttagaatattagggtaaattatgttgggacctctgctagagaacatggccatagagggtgctggtttggtatctaacacagttctt |
202 |
Q |
| |
|
||||||||||||||||||| ||| || ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5685144 |
acctttagaatattagggtcaataatattgggacctctactagagaagatggccatagagggtgctggtttggtatctaacacagttctt |
5685055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University