View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17145_high_19 (Length: 362)
Name: NF17145_high_19
Description: NF17145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17145_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 15 - 340
Target Start/End: Complemental strand, 6234174 - 6233838
Alignment:
| Q |
15 |
taacattcattcataataattcaagaagaatatctgaatccattaacaactcattgatatgatatctcaaatcaaatatatatata--------atacac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6234174 |
taacattcattcataataattcaagaagaatatctgaatccattaacaactcattgatatgatatctcaaatcaaatatatatatatatatataatacac |
6234075 |
T |
|
| Q |
107 |
acaaaagtcaataccacttatgaaacggttttagcggcgacgggggcgggattgagtggtgctcgaacggcggcg---ctgtcttcgtcgtcgggatcgt |
203 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6234074 |
acaaaagtgaataccacttatgaaacggttttagcggcgacgggggcgggattgagtggtgctcgaacggcggcggcgctgtcttcgtcgtcgggatcgt |
6233975 |
T |
|
| Q |
204 |
aatcagggttgagattgcgatcgatggcttgacgaccttgttcgaggcagggtttacaagctatctcgatagtgatccaacctagaatcactcctaccac |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6233974 |
aatcagggttgagattgcgatcgatggcttgacgaccttgttcgaggcagggtttacaagctatctcgatagtgatccaacctagaatcactcctaccac |
6233875 |
T |
|
| Q |
304 |
tgcgatcactgcaccggtgattgctcccatgatccct |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6233874 |
tgcgatcactgcaccggtgattgctcccatgatccct |
6233838 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University