View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17145_high_46 (Length: 218)
Name: NF17145_high_46
Description: NF17145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17145_high_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 120; Significance: 1e-61; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 14 - 199
Target Start/End: Original strand, 46750 - 46935
Alignment:
| Q |
14 |
attatactaggcatatataagcaaggcgcaggttcaagtcatatcgcttcttgcttttaatttttcttctgtatattatatatannnnnnncnnnnnnnt |
113 |
Q |
| |
|
|||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
46750 |
attatattaggcatatataagcaaggcgctggttcaagtcatatcgcttcttgcttttaatttttcttctgtatattatatatatttttgtcaaaaaaat |
46849 |
T |
 |
| Q |
114 |
gtccctgggaagacttgaaccggctcccccacgctacatttaaaagatcccaactagtggaactattgactactcacagatccttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |||||||||| |
|
|
| T |
46850 |
gtccctgggaagacttgaaccggctcccccacgctacatttaaaagatcccaactggtggaactattgattacttgcagatccttt |
46935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 24915812 - 24915755
Alignment:
| Q |
121 |
ggaagacttgaaccggctcccccacgctacatttaaaagatcccaactagtggaacta |
178 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| || || |||||| | |||||||| |
|
|
| T |
24915812 |
ggaagaattgaaccggctcccccacgctacattttaaggaacccaaccactggaacta |
24915755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 36 - 97
Target Start/End: Complemental strand, 24915894 - 24915833
Alignment:
| Q |
36 |
aaggcgcaggttcaagtcatatcgcttcttgcttttaatttttcttctgtatattatatata |
97 |
Q |
| |
|
||||||||||||| ||||||| || || | |||||||||||||| |||||| ||||||||| |
|
|
| T |
24915894 |
aaggcgcaggttcgagtcatactgcctcctacttttaatttttctactgtattttatatata |
24915833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University