View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17145_low_42 (Length: 241)
Name: NF17145_low_42
Description: NF17145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17145_low_42 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 71 - 223
Target Start/End: Original strand, 48974247 - 48974399
Alignment:
| Q |
71 |
cgccccttagttagtaaagctgtgctgatgaaatgacaatccacaaacacaaaacacagaaatttttgtccaccataaaaagaccagaagatttaacagg |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48974247 |
cgccccttagttagtaaagctgtgctgatgaaatgacaatccacaaacacaaaacacagaaatttttgtccaccataaaaagaccagaagatttaacagg |
48974346 |
T |
|
| Q |
171 |
gaagcaaaagataaccattttgaagttgtcgagggagacgtgcccatctctat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48974347 |
gaagcaaaagataaccattttgaagttgtcgagggagacgtgcccatctctat |
48974399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University