View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17145_low_50 (Length: 203)
Name: NF17145_low_50
Description: NF17145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17145_low_50 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 13 - 188
Target Start/End: Complemental strand, 47127709 - 47127534
Alignment:
| Q |
13 |
atcatcaactagttagccattggtatgtcattcaaaaaatcacaaagctcaataataccagtgtttgaaactttaataaactatgattcctgtgcaggct |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127709 |
atcatcaactagttagccattggtatgtcattcaaaaaatcacaaagctcaataataccagtgtttgaaactttaataaactatgattcctgtgcaggct |
47127610 |
T |
 |
| Q |
113 |
gtttactcatgcagtgattgaaccatttataatagctacaaacagacaactgagtcttcttcatccaattcataag |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47127609 |
gtttactcatgcagtgattgaaccatttataatagctacaaacagacaactgagtcttcttcatccaattcataag |
47127534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 116 - 187
Target Start/End: Complemental strand, 6262958 - 6262887
Alignment:
| Q |
116 |
tactcatgcagtgattgaaccatttataatagctacaaacagacaactgagtcttcttcatccaattcataa |
187 |
Q |
| |
|
|||||||||||| ||||||||||| | ||||| |||||||||||||| ||| | |||||||| ||| |||| |
|
|
| T |
6262958 |
tactcatgcagttgttgaaccatttgttatagcaacaaacagacaacttagtgtgcttcatcctatttataa |
6262887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 116 - 189
Target Start/End: Original strand, 9605574 - 9605647
Alignment:
| Q |
116 |
tactcatgcagtgattgaaccatttataatagctacaaacagacaactgagtcttcttcatccaattcataagt |
189 |
Q |
| |
|
||||||||||||| |||| ||||| || ||||| ||||||||||| || ||| ||||||| || ||| |||||| |
|
|
| T |
9605574 |
tactcatgcagtggttgagccattcatcatagcaacaaacagacatcttagtgttcttcaccctattaataagt |
9605647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University