View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17146_high_31 (Length: 302)
Name: NF17146_high_31
Description: NF17146
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17146_high_31 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 132 - 283
Target Start/End: Original strand, 25355195 - 25355346
Alignment:
| Q |
132 |
gattgttatcagtcatctttttcaatgcaccatgtttaacagaaacaatgattatgacaatacttaggcttgctacatttcaaggcttatatgttgatat |
231 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25355195 |
gattgttatcagtcatctctttcaatgcaccatgtttaacagaaacaatgattatgacaatacttaggcttgctacatttcaaggcttatatgatgatat |
25355294 |
T |
|
| Q |
232 |
ggtatcaaagattgcttgcatactattgcaaggaaaaaataatgatgatgtc |
283 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25355295 |
ggtatcaaagattgcttgcatactattgcaaggaaaaaataatgattatgtc |
25355346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 37 - 87
Target Start/End: Original strand, 25355104 - 25355154
Alignment:
| Q |
37 |
cggtttgaatcatccccttcaataacatcctaaatgaaaagtagatcaata |
87 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25355104 |
cggtttgaatcatccccttcaataacatcctaaatgaaaattagatcaata |
25355154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 127 - 283
Target Start/End: Complemental strand, 15763319 - 15763159
Alignment:
| Q |
127 |
cataggattgttatcagtcatctttttcaatgcaccatgtttaacagaaacaatgattatgacaatacttaggcttgctacatttcaaggcttatatgtt |
226 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
15763319 |
cataggattgttatcagtcatctctttcaatgcaccatgtttaacagaaacaatgattatgacaatactgaggcttgctacatttcaaggcttatatgat |
15763220 |
T |
|
| Q |
227 |
gatatggtatcaaagattgcttgc----atactattgcaaggaaaaaataatgatgatgtc |
283 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
15763219 |
gatatggtatcaaagattgcttgcatatatactattgcaaggaaaaaataatgattatgtc |
15763159 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University