View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17148_low_10 (Length: 362)
Name: NF17148_low_10
Description: NF17148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17148_low_10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 7e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 105 - 259
Target Start/End: Original strand, 44351534 - 44351693
Alignment:
| Q |
105 |
ctgaggcagcagcaaacaagttgaatcagaaacttgaaattgtagcagtgcgaaattcatcatacacaatatgtgaa---gaattagaacaactcttctt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
44351534 |
ctgaggcagcagcaaacaagttgaatcagaaacttgaaattgtagcagtgcgaaattcatcatacacaatatgtgaagttgaatcagaacaactcttctt |
44351633 |
T |
|
| Q |
202 |
ctctctcgttcctcgcgag--tctctccccttccccctggtgcttctcagctgctgcctg |
259 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44351634 |
ctctctcgttcctcgcgagtctctctccccttccccctggtgcttctcagctgctgcctg |
44351693 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 297 - 346
Target Start/End: Original strand, 44351735 - 44351784
Alignment:
| Q |
297 |
aaggtaacccaattcaattgattctccaattgcttgttttaggtttagtt |
346 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44351735 |
aaggtaacccaattcaattgattctccaattgcttgttttaggtttagtt |
44351784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 169 - 226
Target Start/End: Original strand, 7909614 - 7909671
Alignment:
| Q |
169 |
cacaatatgtgaagaattagaacaactcttcttctctctcgttcctcgcgagtctctc |
226 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7909614 |
cacaatatctgaagaatcagaacaactcttcttctctctcgtccctcgcgagtctctc |
7909671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 168 - 226
Target Start/End: Complemental strand, 9682925 - 9682867
Alignment:
| Q |
168 |
acacaatatgtgaagaattagaacaactcttcttctctctcgttcctcgcgagtctctc |
226 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
9682925 |
acactatatgtgaagaatcagaacaactcttcttctctctcgtcccttgcgagtctctc |
9682867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 311 - 344
Target Start/End: Complemental strand, 9682759 - 9682726
Alignment:
| Q |
311 |
caattgattctccaattgcttgttttaggtttag |
344 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
9682759 |
caattcattctccaattgcttgttttaggtttag |
9682726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 259
Target Start/End: Complemental strand, 12761620 - 12761587
Alignment:
| Q |
226 |
ccccttccccctggtgcttctcagctgctgcctg |
259 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
12761620 |
cccctgccccctggtgcttctcagctgctgcctg |
12761587 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University