View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17148_low_14 (Length: 329)
Name: NF17148_low_14
Description: NF17148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17148_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 19 - 314
Target Start/End: Original strand, 42340866 - 42341161
Alignment:
| Q |
19 |
gtagaatcattgcagagggaaggagaagaagcgaccaggaatgacgtcaacaatgtcatttcttcatcgctcggaaggcaatcgtcatccatatactcac |
118 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42340866 |
gtagaatcattgcaaagggaaggagaagaagcgatcaggaatgacgtcaacaatgtcatttcttcatcgctcggaaggcaatcttcatccatatactcac |
42340965 |
T |
|
| Q |
119 |
tcacccttgacgagttccaacacagcctctgtgatagcggcaagaatttcggatccatgaacatggatgagtttctaagtagtatttggaatgcagaaga |
218 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42340966 |
tcaccctcgacgagttccaacacagcctctgtgatagcggcaagaatttcggatccatgaacatggatgagtttctaagtagtatttggaatgcagaaga |
42341065 |
T |
|
| Q |
219 |
aaaccaacaacaagctgcatccaacaataataacagcaacaacaataacttgtctgcagctcagaaagggattagcaaacaggcaagtcttcctcg |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42341066 |
aaaccaacaacaagctgcatccaacaataataacagcaacaacaataacttgtctgcagctcagaaagggattagcaaacaggcaagtcttcctcg |
42341161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University