View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17148_low_21 (Length: 280)
Name: NF17148_low_21
Description: NF17148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17148_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 23 - 270
Target Start/End: Complemental strand, 1734758 - 1734511
Alignment:
| Q |
23 |
aaagagctctaggtatgaggatgatcgcaaagaaaggaagaactcaagggaagaggatgatcgcaaagtaagaaggaactcaagggaagatgatgatcac |
122 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1734758 |
aaagaactctaggtatgaggatgatcgcaaagaaaggaagaactcaagggaagaggatgatcgcaaagtaagaaggaactcaagggaagatgatgatcac |
1734659 |
T |
|
| Q |
123 |
agagagagaaagagctcaagggatgaggatgttcgtggggaaagaaagtacagaggggacgatgattatcatggagagagaaagcgcagcagaagggatg |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1734658 |
agagagagaaagagctcaagggatgaggatgttcgtggggaaagaaagtacagaggggacgatgattatcatggagagagaaagcgcagcagaagggatg |
1734559 |
T |
|
| Q |
223 |
atgatgatggtcatggagaaagaaggcattatagaagggatgatgatg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1734558 |
atgatgatggtcatggagaaagaaggcattatagaagggatgatgatg |
1734511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University