View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17148_low_27 (Length: 239)
Name: NF17148_low_27
Description: NF17148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17148_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 223
Target Start/End: Complemental strand, 32550124 - 32549912
Alignment:
| Q |
11 |
caaaggcagtatctgaggatgatcagcacacaatttgtccctgatcatagacaagtcagacttggaaatcttcttcggaggcaaaccctttctcggtggc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32550124 |
caaaggcagtatctgaggatgatcagcacacaatttgtccctgatcatagacaagtcagacttggaaatcttctttggaggcaaaccctttctcggtggc |
32550025 |
T |
 |
| Q |
111 |
acagaagccttcacgtccacatcgtagtgcatgataatgctttgtggattgaaagcaaccggaaaatgattgacacgaagtctgcagtctcgaattgaca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32550024 |
acagaagccttcacgtccacatcgtagtgcatgataatgctttgtggattgaaagcaaccggaaaatgattgacacgaagtctgcagtctcgaattgaca |
32549925 |
T |
 |
| Q |
211 |
ctgtccctccctt |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32549924 |
ctgtccctccctt |
32549912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University