View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17149_high_13 (Length: 307)
Name: NF17149_high_13
Description: NF17149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17149_high_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 135 - 292
Target Start/End: Original strand, 46920054 - 46920210
Alignment:
| Q |
135 |
cttctccaagttgtacgtaacatttagagatgcctcttatctcgttggcatttaccaattagacacacagaggtggttacaaaataccgcatagaagtag |
234 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46920054 |
cttctccaagttgtacgtaacatttagagatgc-tcttatctcgttggcatttaccaattagacacacagaggtggttacaaaataccgcatagaagtag |
46920152 |
T |
|
| Q |
235 |
taacatgacattagaaatctgcatattagatgacccatatacttctattggtcatatc |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46920153 |
taacatgacattagaaatctgcatattagatgacccatatacttctattggtcatatc |
46920210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 25 - 73
Target Start/End: Original strand, 46919944 - 46919992
Alignment:
| Q |
25 |
ataacacaaaaattttcttttttacttctttaggacatatgttgaccct |
73 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
46919944 |
ataacacaaaaattttcttttctacttctttaggacaaatgttgaccct |
46919992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University