View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17149_high_17 (Length: 273)
Name: NF17149_high_17
Description: NF17149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17149_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 6)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 26 - 160
Target Start/End: Complemental strand, 11118527 - 11118393
Alignment:
| Q |
26 |
agcaaaggaagatttaagttgatctagactggagctgggacctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11118527 |
agcaaaggaagatttaagttgatctagactggagctgggacctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaat |
11118428 |
T |
|
| Q |
126 |
ggaacgatccaacctggacccccactctgtgaata |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11118427 |
ggaacgatccaacctggacccccactctgtgaata |
11118393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 26 - 156
Target Start/End: Complemental strand, 11110577 - 11110447
Alignment:
| Q |
26 |
agcaaaggaagatttaagttgatctagactggagctgggacctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaat |
125 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
11110577 |
agcaaaggcagatttaagtcgatctagactgaagttgggacctggaagattttgattggcaagggattgatttgctgttagactatcccttcttcctagt |
11110478 |
T |
|
| Q |
126 |
ggaacgatccaacctggacccccactctgtg |
156 |
Q |
| |
|
||||| |||||||||||||||| |||||| |
|
|
| T |
11110477 |
ggaacctcccaacctggacccccagtctgtg |
11110447 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 26 - 162
Target Start/End: Original strand, 10793748 - 10793884
Alignment:
| Q |
26 |
agcaaaggaagatttaagttgatctagactggagctgggacctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaat |
125 |
Q |
| |
|
|||||||||||||||||||||| |||| || || || ||||||||||| ||| || |||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
10793748 |
agcaaaggaagatttaagttgacttagattgaagaaaggggctggaagattttgatttgcgagggttcgatttgctgttagactatcccttcttcccaat |
10793847 |
T |
|
| Q |
126 |
ggaacgatccaacctggacccccactctgtgaatata |
162 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| |
|
|
| T |
10793848 |
ggaacgatccaaccgggacctttactctgtgaatata |
10793884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 67 - 129
Target Start/End: Complemental strand, 11097455 - 11097393
Alignment:
| Q |
67 |
ctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaatggaa |
129 |
Q |
| |
|
||||||| ||| ||| ||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
11097455 |
ctggaaggttttgatttgcaagggcttggtttgctgttaaactatcccttcttcccaatggaa |
11097393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 63 - 127
Target Start/End: Complemental strand, 11172446 - 11172382
Alignment:
| Q |
63 |
ggacctggaagatttctattggcaagggattgatttgctgttagactatcccttcttcccaatgg |
127 |
Q |
| |
|
|||| |||||||||| |||| ||||||| | |||||||||||| |||||| |||||||| ||||| |
|
|
| T |
11172446 |
ggacttggaagatttatattagcaagggttagatttgctgttaaactatctcttcttcctaatgg |
11172382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 84 - 130
Target Start/End: Complemental strand, 11178577 - 11178531
Alignment:
| Q |
84 |
gcaagggattgatttgctgttagactatcccttcttcccaatggaac |
130 |
Q |
| |
|
|||||||| | ||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
11178577 |
gcaagggaattatttgctgttaaactatcccttcttcctaatggaac |
11178531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University