View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17149_high_18 (Length: 256)
Name: NF17149_high_18
Description: NF17149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17149_high_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 31102241 - 31101987
Alignment:
| Q |
1 |
atcttattgcacacataacaaattctcttcaaaatggaaatgatggaaaaaagtttattcaagacatagctcagcaattgcgcgagctacggaaaattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31102241 |
atcttattgcacacataacaaattctcttcaaaatggaaatgatggaaaaaaatttattcaagacatagctcagcaattgcgcgagctacggaaaattgg |
31102142 |
T |
|
| Q |
101 |
aataagatcaagatggtaaggagactgtttttcgcttttctttcatttttatgtacaaagaaacttttcatacggcatgttaatatacattgtttataac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31102141 |
aataagatcaagatggtaaggagactgtttttcgcttttctttcatttttatgtacaaagaaacttttcatacggcatgttaatatacattgtttataac |
31102042 |
T |
|
| Q |
201 |
tgtgtcgatggacaccgtataatcccactcagaatattcttcattttcttcgaca |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
31102041 |
tgtgtcgatggacaccgtataatcccactcagaatattcttcatttgctttgaca |
31101987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University