View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17149_low_12 (Length: 372)
Name: NF17149_low_12
Description: NF17149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17149_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 320; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 13 - 355
Target Start/End: Complemental strand, 22528251 - 22527911
Alignment:
| Q |
13 |
aaaatatacaaagaggatgatatcttaataattttaaaggctttgtcaaatttttacacgagacgattctcttgattctcctagggtatcaaaattcaaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22528251 |
aaaatatacaaagaggatgatatcttaataattttaaaggctttgtcaaatttttacacgagacgattctcttgattctcctagggtatcaaaattcaaa |
22528152 |
T |
 |
| Q |
113 |
gaattgaacctgattgccatcaaaggctgcaacatgttgcaagaaattaataatttgtcagcatcttactcttcaatctgaatatcaatacgaattatct |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22528151 |
gaattgaacctgattgccatcaaaggctgcaacattttgcaagaaattaataatttgtcagcatcttactctacaatctgaatatcaatacgaattatct |
22528052 |
T |
 |
| Q |
213 |
acaaacagaacaaagatatatccgtcggaatcttgttcaacaatgtagacatagaatgattcatgcaacttcttcaactttagacatgacagagaatctg |
312 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22528051 |
acaaacagaacaaagatatatctgtcggaa--ttgttcaacaatgtagacatagaatgattcatgcaacttcttcaactttagacatgacagagaatctg |
22527954 |
T |
 |
| Q |
313 |
ctaggtcttggctggaaattgcaacgtctgcgctggttatacg |
355 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22527953 |
ctaggtcttggctggaaattgcaacgtctgcgctggttatacg |
22527911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University