View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17149_low_19 (Length: 279)
Name: NF17149_low_19
Description: NF17149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17149_low_19 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 238; Significance: 1e-132; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 7 - 264
Target Start/End: Original strand, 44018374 - 44018631
Alignment:
| Q |
7 |
gaagcaaaggaagaagttgtcgtagttctcatgcgtttgtcatttggtttgactttgtcttcattaaaatcatcaagaaaacgttttgcagccattttgg |
106 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44018374 |
gaagcaaaagaagatgttgtcgtagttctcatgcgtttgtcatttggtttgactttgtcttcattaaaatcatcaagaaaacgttttgcagccattttgg |
44018473 |
T |
|
| Q |
107 |
taaagaatttaggaccagcttgctttgatgttattgttgcagtgaggtagctagctagcttggatgaatgaaatgcagaatgagacgattgagtttttat |
206 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44018474 |
taaagaatttagaaccagcttgctttgatgttattgttgcagtgaagtagctagctagtttggatgaatgaaatgcagaatgagacgattgagtttttat |
44018573 |
T |
|
| Q |
207 |
tatatgagaaaagcagaaggttcttggaatgttggtggaaataacgtagcaaataact |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44018574 |
tatatgagaaaagcagaaggttcttggaatgttggtggaaataacgtagcaaataact |
44018631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 23 - 145
Target Start/End: Complemental strand, 44027897 - 44027775
Alignment:
| Q |
23 |
ttgtcgtagttctcatgcgtttgtcatttggtttgactttgtcttcattaaaatcatcaagaaaacgttttgcagccattttggtaaagaatttaggacc |
122 |
Q |
| |
|
|||| |||||||| || |||||||||||||||||| ||||||||| |||| ||||||| | ||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44027897 |
ttgttgtagttcttatccgtttgtcatttggtttgtctttgtcttgattagaatcatcgaaaaaccgttttgcagccattttggtaaagaatttagaacc |
44027798 |
T |
|
| Q |
123 |
agcttgctttgatgttattgttg |
145 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
44027797 |
agcttgctttgatgttattgttg |
44027775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 167 - 249
Target Start/End: Complemental strand, 44027741 - 44027661
Alignment:
| Q |
167 |
tggatgaatgaaatgcagaatgagacga-ttgagtttttattatatgagaaaagcagaaggttcttggaatgttggtggaaata |
249 |
Q |
| |
|
||||||||||||| ||| |||||||||| |||||||| ||||||| |||||| ||||| |||| ||||| |||| ||||||| |
|
|
| T |
44027741 |
tggatgaatgaaaggcataatgagacgatttgagttt---ttatatgggaaaagaagaagcttctaggaatattggaggaaata |
44027661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University