View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17149_low_24 (Length: 244)
Name: NF17149_low_24
Description: NF17149
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17149_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 13 - 223
Target Start/End: Original strand, 29189351 - 29189571
Alignment:
| Q |
13 |
aagaatattctactagatgacacttggcaccactatgatctaattctacttgtttgtgatcttggtctatatttagattgatagtgaatcttgtagaatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29189351 |
aagaatattctactagatgacacttggcaccactatgatctaattctacttgtttgtgatcttggtctatatttagattgatagtgaatcttgtagaatc |
29189450 |
T |
|
| Q |
113 |
acactttgccatcatgattttgagaaaagtcacactttgaaacttcattagaatcac--------gattttgccaaactcatctttgttgcatagacac- |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||| |||||||||||||| |
|
|
| T |
29189451 |
acactttgccatcatgattttgagaaaagtcacactttgaaacttcaatagaattacaatgtcgttattttgccaaactcatctctgttgcatagacaca |
29189550 |
T |
|
| Q |
204 |
-ttctgattgaaggtgtgtct |
223 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
29189551 |
attctgattgaaggtgtgtct |
29189571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 187 - 221
Target Start/End: Original strand, 45730044 - 45730078
Alignment:
| Q |
187 |
ctttgttgcatagacacttctgattgaaggtgtgt |
221 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45730044 |
ctttgttgcatggacacttctgattgaaggtgtgt |
45730078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 185 - 222
Target Start/End: Original strand, 24462205 - 24462242
Alignment:
| Q |
185 |
atctttgttgcatagacacttctgattgaaggtgtgtc |
222 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
24462205 |
atctttgttgcacagacacttctgattgaaggcgtgtc |
24462242 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University