View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1714_high_33 (Length: 246)
Name: NF1714_high_33
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1714_high_33 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 97 - 227
Target Start/End: Complemental strand, 6888782 - 6888652
Alignment:
| Q |
97 |
taacattattatataatttcttgtaacttctatgaaaaccacatgatattgtaacatagtaaaatccccaaagggggtgaacctatgtagcttattactg |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6888782 |
taacattattatataatttcttgtaacttctatgaaaaccacatgatattgtaacatagtaaaatccccaaagggggtgaacctatgtagcttattactg |
6888683 |
T |
 |
| Q |
197 |
tattccacgttggatttgataatgtgatagc |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6888682 |
tattccacgttggatttgataatgtgatagc |
6888652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 12 - 106
Target Start/End: Complemental strand, 6889255 - 6889161
Alignment:
| Q |
12 |
tattgacccattattgtgatagtctaatctctctctctgaactcaaatatccattggtatagcaaatagaaatcacgtatctatataacattatt |
106 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6889255 |
tattgtcccattattgtgatagtctaatctctttctctgaactcaaatatccattggtatagcaaatagaaatcacctatctatataacattatt |
6889161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University