View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1714_high_41 (Length: 236)

Name: NF1714_high_41
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1714_high_41
NF1714_high_41
[»] chr8 (2 HSPs)
chr8 (58-225)||(43082593-43082760)
chr8 (1-37)||(43082759-43082795)


Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 58 - 225
Target Start/End: Complemental strand, 43082760 - 43082593
Alignment:
58 attagagttgctgcctgtctgtttgcgacagatcgaggtatagccatttgttaacggattgacagaatgcacaagatgctcataaaattagtcacaacaa 157  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43082760 attagagttgctgcctgtctgtttgcgacagatcgaggtatagccttttgttaacggattgacagaatgcacaagatgctcataaaattagtcacaacaa 43082661  T
158 ccatgaccggaactgagttagtgtttcatggctaagacctactacattgtgtctgtgctagagatgat 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43082660 ccatgaccggaactgagttagtgtttcatggctaagacctactacattgtgtctgtgctagagatgat 43082593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 43082795 - 43082759
Alignment:
1 aggttttgaactcatcacattcgatggccaagaacat 37  Q
    |||||||||||||||||||||||||||||||||||||    
43082795 aggttttgaactcatcacattcgatggccaagaacat 43082759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University