View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1714_high_46 (Length: 213)
Name: NF1714_high_46
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1714_high_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 13 - 74
Target Start/End: Complemental strand, 40758046 - 40757985
Alignment:
| Q |
13 |
acgcgttctgttctgctgctttcacacatccattatgtattatcatagtatcagattagaag |
74 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40758046 |
acgcgttctgttctgctgctttcacacatccattatgtattatcatagtatcagattagaag |
40757985 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 75 - 121
Target Start/End: Original strand, 40756077 - 40756123
Alignment:
| Q |
75 |
taggagggagaatattcctactttagtttcttgacaaaagtcctaaa |
121 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40756077 |
taggagagagaatattcctactttagttttttgacaaaagtcctaaa |
40756123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University