View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1714_high_50 (Length: 201)
Name: NF1714_high_50
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1714_high_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 1 - 188
Target Start/End: Complemental strand, 19205689 - 19205502
Alignment:
| Q |
1 |
tctcgtgcatttaagcattttccgggcggagcgatgaaggaaacatgtagaaaggagggggaaaggggaaagatcaaaggagactcaaagaagattcatc |
100 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
19205689 |
tctcttgcatttaagcattttccggacggagcgatgaaggaaacaggtagaaaggagggggaaaggggatagatcaaatgagactcaaagaagattcatc |
19205590 |
T |
|
| Q |
101 |
ttgcgatgaggggaaatcttggagcgatggagagggttcttggagcgattagggttcccccgagtagtcttctcatacccatatgatg |
188 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
19205589 |
ttgcgatgaggggaaatcttggagcgaaggagagggttcattgagcgattagggttcccccgaacaatcttctcatacccatatgatg |
19205502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University