View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1714_low_16 (Length: 380)
Name: NF1714_low_16
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1714_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 346; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 346; E-Value: 0
Query Start/End: Original strand, 9 - 374
Target Start/End: Original strand, 44975046 - 44975411
Alignment:
| Q |
9 |
tcaatgagagaccaatcttgttaagagaaacattaagtggggtctataggctatcatcttatcttatagcaaatacacttgttttcttgccatatttgct |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44975046 |
tcaatgagagaccaatcttgttaagagaaacatcaagtggtgtttataggctatcatcttatcttatagcaaatacacttgttttcttgccatatttgct |
44975145 |
T |
|
| Q |
109 |
agtagttgctgttatctactctattccagtttacttcttagtgggtctttgtagttcttggctatcttttgcttactttgttttggttatttgggtcata |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44975146 |
agtagttgctgttatctactctattccagtttactttttagtgggtctttgtagttcttggctatcttttgcttactttgttttggttatttgggtcata |
44975245 |
T |
|
| Q |
209 |
gttcttatggcaaactcatttgttctgttcttgagttctttagcaccaaactacattgccggaacttcactcatgacagtgctacttgcagcattttttc |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44975246 |
gttcttatggcaaactcatttgttctgttcttgagttctttagcaccaaactacattgctggaacttcactcatgacagtgctacttgcagcattttttc |
44975345 |
T |
|
| Q |
309 |
tgttctctggatactttatatctaaggattgtttacctaagtattggctcttcatgcacttctttt |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44975346 |
tgttctctggatactttatatctaaggattgtttacctaagtattggctcttcatgcacttctttt |
44975411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University