View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1714_low_26 (Length: 302)
Name: NF1714_low_26
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1714_low_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 34687031 - 34686742
Alignment:
| Q |
1 |
tgcacaattgaatcacattagtgtcttagtgttaatttgtataattcatactaaataaataaataa----tttgcattgctttgcatgtagtcataccca |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34687031 |
tgcacaattgaatcacattagtgtcttagtgttaatttgtataattcatactaaataaataaataaataatttgcattgctttgcatgtagtcataccca |
34686932 |
T |
|
| Q |
97 |
tcaatgacagattacctaaagtctgggctatacaaatgggccggtgatgcagatagttatgagaaagatggtccctacattgagctggtaacttcaccaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34686931 |
tcaatgacagattacctaaagtctgggctatacaaatgggccggtgatgcagatagttatgagaaagatggtccctacattgagctggtaacttcaccaa |
34686832 |
T |
|
| Q |
197 |
ataatcctgatggacatgtgaggaagtctaaggtcaatagaagtcaaggacttctggttcatgatcttgcctactactggccgcaataca |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34686831 |
ataatcctgatggacatgtgaggaagtctaaggtcaatagaagtcaaggacttctggttcatgatcttgcctactactggccgcaataca |
34686742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 5e-19; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 94 - 210
Target Start/End: Complemental strand, 43612874 - 43612758
Alignment:
| Q |
94 |
ccatcaatgacagattacctaaagtctgggctatacaaatgggccggtgatgcagatagttatgagaaagatggtccctacattgagctggtaacttcac |
193 |
Q |
| |
|
||||||||| |||||| || || || || |||||||||||||| || |||||||| |||| | | ||||||||||| |||||||||||||| ||||| | |
|
|
| T |
43612874 |
ccatcaatggcagatttccagaaatcaggactatacaaatgggctggagatgcagagagttttaacaaagatggtccttacattgagctggttacttctc |
43612775 |
T |
|
| Q |
194 |
caaataatcctgatgga |
210 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
43612774 |
ctaataatcctgatgga |
43612758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University