View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1714_low_30 (Length: 263)
Name: NF1714_low_30
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1714_low_30 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 111 - 263
Target Start/End: Complemental strand, 29092806 - 29092654
Alignment:
| Q |
111 |
caagtcattggttcttgatctgctctcatgatcagtgcttctcattaccatgttatttctctctaactttacaagaaaaatttgtgattctttgctggca |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29092806 |
caagtcattggttcttgatctgctctcatgatcagtgcttctcattaccatgttatttctctctaactttacaagaaaaatttgtgattctttgctggca |
29092707 |
T |
 |
| Q |
211 |
ttacttcattttagtgcccatgtctttggtactaacatagagattgtggcaac |
263 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29092706 |
ttacttcatatcagtgcccatgtctttggtactaacatagagattgtggcaac |
29092654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 9 - 77
Target Start/End: Complemental strand, 29092871 - 29092803
Alignment:
| Q |
9 |
gattatactgcaaataacttactattttgttaatttattccaaagnnnnnnnattggagtatttacaag |
77 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29092871 |
gattacactgcaaataactttctattttgttaatttattccaaagtttttttattggagtatttacaag |
29092803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University