View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1714_low_35 (Length: 246)
Name: NF1714_low_35
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1714_low_35 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 234
Target Start/End: Original strand, 33103905 - 33104133
Alignment:
| Q |
1 |
ttttacattaaacaccattattgcttccaatcccatttatttccattatattttcaacaataaagtaatttaattattgtacatatactact---catct |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
33103905 |
ttttacattaaacaccattattgcttccaatcccattt----ccattatattttcaacagtaaattaatttaattattgtacatatactactaatcatct |
33104000 |
T |
|
| Q |
98 |
caattatatcatgttagtaattttcttttgtaccatgaaaaatttaataatttattgaaaaaagaacgaacaatcataaaacaatgaagagggtacaatg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33104001 |
caattatatcatgttagtaattttcttttgtaccatgaaaaatttaataatttattgaaaaaa----gaacaatcataaaacaatgaagagggtacaatg |
33104096 |
T |
|
| Q |
198 |
gcagtggaatgaaagtgatggtaacatggtatgatga |
234 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33104097 |
gcagtgaaatgaaagtgatggtaacatggtatgatga |
33104133 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University