View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1714_low_40 (Length: 240)
Name: NF1714_low_40
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1714_low_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 50677617 - 50677832
Alignment:
| Q |
1 |
tgcaatgaaatcccagccacaaaacatatgaaaattgaaaagtgttattcaatcccataatttcacataaaaacactcaacttttaacatctaagttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50677617 |
tgcaatgaaatcccagccacaaaacatatgaa-------aagtgttattcaatcccataatttcacataaaaacactcaacttttaacatctaagttttg |
50677709 |
T |
 |
| Q |
101 |
taaaagttatctccgataatttgtcaagaattctttgattttgccttaaatcgaacatgcggcatgcaggaaatgctaccgatgcttgtatgattagcgt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50677710 |
taaaagttatctccgataatttgtcaagaatcctttgattttaccttaaatcgaacatgcggcatgcaggaaatgctaccgatgcttgtatgattagcgt |
50677809 |
T |
 |
| Q |
201 |
tatacacgtattgcggtgtagat |
223 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
50677810 |
tatacacgtattgtggtgtagat |
50677832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University