View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1714_low_42 (Length: 236)
Name: NF1714_low_42
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1714_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 9e-88; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 58 - 225
Target Start/End: Complemental strand, 43082760 - 43082593
Alignment:
| Q |
58 |
attagagttgctgcctgtctgtttgcgacagatcgaggtatagccatttgttaacggattgacagaatgcacaagatgctcataaaattagtcacaacaa |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082760 |
attagagttgctgcctgtctgtttgcgacagatcgaggtatagccttttgttaacggattgacagaatgcacaagatgctcataaaattagtcacaacaa |
43082661 |
T |
|
| Q |
158 |
ccatgaccggaactgagttagtgtttcatggctaagacctactacattgtgtctgtgctagagatgat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082660 |
ccatgaccggaactgagttagtgtttcatggctaagacctactacattgtgtctgtgctagagatgat |
43082593 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 37
Target Start/End: Complemental strand, 43082795 - 43082759
Alignment:
| Q |
1 |
aggttttgaactcatcacattcgatggccaagaacat |
37 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43082795 |
aggttttgaactcatcacattcgatggccaagaacat |
43082759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University