View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1714_low_47 (Length: 213)

Name: NF1714_low_47
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1714_low_47
NF1714_low_47
[»] chr2 (2 HSPs)
chr2 (13-74)||(40757985-40758046)
chr2 (75-121)||(40756077-40756123)


Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 13 - 74
Target Start/End: Complemental strand, 40758046 - 40757985
Alignment:
13 acgcgttctgttctgctgctttcacacatccattatgtattatcatagtatcagattagaag 74  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40758046 acgcgttctgttctgctgctttcacacatccattatgtattatcatagtatcagattagaag 40757985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 75 - 121
Target Start/End: Original strand, 40756077 - 40756123
Alignment:
75 taggagggagaatattcctactttagtttcttgacaaaagtcctaaa 121  Q
    |||||| |||||||||||||||||||||| |||||||||||||||||    
40756077 taggagagagaatattcctactttagttttttgacaaaagtcctaaa 40756123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University