View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1714_low_48 (Length: 212)
Name: NF1714_low_48
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1714_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 198
Target Start/End: Complemental strand, 29092518 - 29092324
Alignment:
| Q |
1 |
cctgttgtaaaatgttcggttgagagttagnnnnnnnntaagtatgcacaaatgttcattattatcgtatatgaatatgcgtgtcggaagagtgtccacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29092518 |
cctgttgtaaaatgttcggttgagagttagaaaaaaaataagtatacacaaatgttcattattatcgtatatgaatatgcgtgtcggaagagtgtccacg |
29092419 |
T |
 |
| Q |
101 |
atgtattgaagtnnnnnnnnnnnngtgtttattgggacacttgtctgagttattcaacacacatcgtacattttgtacgttcatcagacatcgatatt |
198 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
29092418 |
atgtattgaagt---aaaaaaaaagtgtttattgggacacttgtctgagttattcaacacacatcgtatgttttgtacgttcatcggacatcgatatt |
29092324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University