View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1714_low_49 (Length: 210)

Name: NF1714_low_49
Description: NF1714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1714_low_49
NF1714_low_49
[»] chr2 (1 HSPs)
chr2 (2-192)||(41943295-41943485)


Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 2 - 192
Target Start/End: Complemental strand, 41943485 - 41943295
Alignment:
2 ataatgcatatttctctgggtttttaatgtcatgtttctctctttctatcgttttgtaataatactaccaaaaacttattagtaatcttgagttacatta 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41943485 ataatgcatatttctctgggtttttaatgtcatgtttctctctttctatcgttttgtaataatactaccaaaaacttattagtaatcttgagttacatta 41943386  T
102 tgcaacataaactttatgccatagcaatactaaacatttattctcataaaaattatgtagatcccactgctttatgttctcaagtgtctaa 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41943385 tgcaacataaactttatgccatagcaatactaaacatttattctcataaaaattatgtagatcccactgctttatgttctcaagtgtctaa 41943295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University