View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715-Insertion-1 (Length: 126)
Name: NF1715-Insertion-1
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715-Insertion-1 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 111; Significance: 2e-56; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 8 - 126
Target Start/End: Original strand, 31910312 - 31910430
Alignment:
| Q |
8 |
gtttgctagcatagaattatgggacctgctaaaatggaccgtggtccgcaacagatcacatttttcattcaatctcaatctctattacactctttcacaa |
107 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31910312 |
gtttgctagcatagaattgtgggagctgctaaaatggaccgtggtccgcaacagatcacatttttcattcaatctcaatctctattacactctttcacaa |
31910411 |
T |
|
| Q |
108 |
attttacattctagcacca |
126 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
31910412 |
attttacattctagcacca |
31910430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 8 - 81
Target Start/End: Original strand, 31902976 - 31903049
Alignment:
| Q |
8 |
gtttgctagcatagaattatgggacctgctaaaatggaccgtggtccgcaacagatcacatttttcattcaatc |
81 |
Q |
| |
|
||||||||||||||||| ||||| | |||||||||||| |||||| ||||||||| |||| ||||||||||| |
|
|
| T |
31902976 |
gtttgctagcatagaatcctgggaacgactaaaatggaccatggtccacaacagatcgcattattcattcaatc |
31903049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000004; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 34 - 83
Target Start/End: Original strand, 13643241 - 13643290
Alignment:
| Q |
34 |
tgctaaaatggaccgtggtccgcaacagatcacatttttcattcaatctc |
83 |
Q |
| |
|
|||||||||| ||| | |||| ||||| |||||||||||||||||||||| |
|
|
| T |
13643241 |
tgctaaaatgaaccattgtccacaacatatcacatttttcattcaatctc |
13643290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 28; E-Value: 0.0000006
Query Start/End: Original strand, 37 - 80
Target Start/End: Original strand, 13646093 - 13646136
Alignment:
| Q |
37 |
taaaatggaccgtggtccgcaacagatcacatttttcattcaat |
80 |
Q |
| |
|
||||||||||| | |||| || |||||||||||||||||||||| |
|
|
| T |
13646093 |
taaaatggaccattgtccacaccagatcacatttttcattcaat |
13646136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University