View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1715-Insertion-4 (Length: 220)
Name: NF1715-Insertion-4
Description: NF1715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1715-Insertion-4 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 220
Target Start/End: Complemental strand, 47558917 - 47558705
Alignment:
| Q |
8 |
atttcaacggagatggtttgataacgaaacacaattgtttatttgttgttgataagcaacaccaattagctcataaatatgctgtatcttcagctatttg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47558917 |
atttcaacggagatggtttgataacgaaacacaattgtttattttttgttgataagcaacaccaattagctcataaatatgctgtatcttcagctatttg |
47558818 |
T |
|
| Q |
108 |
gtatcccattgatactggtttattcatcactggttcttatgatcatcatgttaatgtttgggacactaacaccactcaggttctcttcaatcttatcatc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47558817 |
gtatcccattgatactggtttattcatcactggttcttatgatcatcatgttaatgtttgggacactaacaccactcaggttctcttcaatcttatcatc |
47558718 |
T |
|
| Q |
208 |
gtcattctgtgta |
220 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47558717 |
gtcattctgtgta |
47558705 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University