View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17151_low_9 (Length: 217)
Name: NF17151_low_9
Description: NF17151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17151_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 123 - 201
Target Start/End: Original strand, 26672282 - 26672360
Alignment:
| Q |
123 |
ttgaatgtatgaatgagagaggggaactgacatggaagagcgaaacgatcgatggggctggacattgcgatgatgagag |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26672282 |
ttgaatgtatgaatgagagaggggaactgacatggaagagcgaaacgatcgatggggctggacattgcgatgatgagag |
26672360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 26672160 - 26672219
Alignment:
| Q |
1 |
actagaactaccagaaatcttaaaatcagattttctttcggttcttttttcatcactacc |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26672160 |
actagaactaccagaaatcttaaaatcagattttctttcggttcttttttcatcactacc |
26672219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University