View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17151_low_9 (Length: 217)

Name: NF17151_low_9
Description: NF17151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17151_low_9
NF17151_low_9
[»] chr4 (2 HSPs)
chr4 (123-201)||(26672282-26672360)
chr4 (1-60)||(26672160-26672219)


Alignment Details
Target: chr4 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 123 - 201
Target Start/End: Original strand, 26672282 - 26672360
Alignment:
123 ttgaatgtatgaatgagagaggggaactgacatggaagagcgaaacgatcgatggggctggacattgcgatgatgagag 201  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26672282 ttgaatgtatgaatgagagaggggaactgacatggaagagcgaaacgatcgatggggctggacattgcgatgatgagag 26672360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 1 - 60
Target Start/End: Original strand, 26672160 - 26672219
Alignment:
1 actagaactaccagaaatcttaaaatcagattttctttcggttcttttttcatcactacc 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26672160 actagaactaccagaaatcttaaaatcagattttctttcggttcttttttcatcactacc 26672219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University