View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_high_20 (Length: 464)
Name: NF17152_high_20
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 5e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 5e-63
Query Start/End: Original strand, 314 - 451
Target Start/End: Complemental strand, 34971887 - 34971752
Alignment:
| Q |
314 |
gaaaagggaatgcttaagatcaaacacataaaatcctatatagaaattttaaattttccgaaatatagaaactagaaaatgaactcacttcagttccacg |
413 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34971887 |
gaaaagggaatgcttaagatcaaacacataaaatcttatatagaaattttaaattttccgaaatatagaaactag--aatgaactcacttcagttccacg |
34971790 |
T |
 |
| Q |
414 |
acggaggagctccctagccagaggaagcatccctagaa |
451 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34971789 |
acggaggagctccctagccagaggaagcatccctagaa |
34971752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University