View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_high_57 (Length: 309)
Name: NF17152_high_57
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_high_57 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 80; Significance: 2e-37; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 217 - 300
Target Start/End: Complemental strand, 45604971 - 45604888
Alignment:
| Q |
217 |
catatttatttttctttgtttatcgaaccaacacctattgcgtcatagtcttaaacacaaggacaagaagaattgtaaacttct |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45604971 |
catatttatttttctttgtttatcgaaccaacacctattgcgtcatagtctcaaacacaaggacaagaagaattgtaaacttct |
45604888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 58 - 174
Target Start/End: Complemental strand, 45605122 - 45605014
Alignment:
| Q |
58 |
ttaaaattatctaagagtctaatgatcgacggtgttttttaaaagtagaaattcatatcgttcctcgtctttactattaagacgataagacgaggacatg |
157 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
45605122 |
ttaaaattatctaagagtctaatgatcgacggtgttttttagaagtagaaattcacatcgttccttgtctttactattaag--------acgaggacatg |
45605031 |
T |
 |
| Q |
158 |
atcgacgtcggtttgac |
174 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
45605030 |
atcgacgtcggtttgac |
45605014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 9 - 55
Target Start/End: Complemental strand, 45605192 - 45605146
Alignment:
| Q |
9 |
gagatgaaataaacctatgtggtgagattggggtggaccatttgata |
55 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45605192 |
gagatgaaataaacctatgtggtgagattggggtggaccatttgata |
45605146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University