View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_high_63 (Length: 290)
Name: NF17152_high_63
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_high_63 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 153736 - 154010
Alignment:
| Q |
1 |
attgtggggaaagaagggcccatggttcatacaggtgcttgcattgctaatttactcggacaaggtggttcacgtaaatatcgactcacctggaaatggc |
100 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
153736 |
attgtggggaaagaaggacccatggttcatacaggtgcttgcattgctaatttactcggacaaggtggttcgcgtaaatatcgactcacctggaaatggc |
153835 |
T |
 |
| Q |
101 |
tcagatacttcaaaaatgatagagataggagggatttgatcacgtgcggtgcagctgctggtgttgccgctgccttccgtgcccccgttggtggtgttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153836 |
tcagatacttcaaaaatgatagagataggagggatttgatcacgtgcggtgcagctgctggtgttgccgctgccttccgtgcccccgttggtggtgttct |
153935 |
T |
 |
| Q |
201 |
gttcgcactcgaagaggcagcttcatggtggaggagtgctcttctgtggcgcacattctttaccactgcagtagt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
153936 |
gttcgcactcgaagaggcagcttcatggtggaggagtgctcttctgtggcgcacattctttaccactgcagtagt |
154010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 2 - 229
Target Start/End: Complemental strand, 56471081 - 56470854
Alignment:
| Q |
2 |
ttgtggggaaagaagggcccatggttcatacaggtgcttgcattgctaatttactcggacaaggtggttcacgtaaatatcgactcacctggaaatggct |
101 |
Q |
| |
|
||||||| || ||||| || ||||| ||||| ||||||||||| | ||| |||| ||||||||||||||| |||||| |||| ||||||||| || | |
|
|
| T |
56471081 |
ttgtgggtaaggaaggacctatggtgcatactggtgcttgcataggaaatctacttggacaaggtggttcaaaaaaatatggactgacctggaaagggtt |
56470982 |
T |
 |
| Q |
102 |
cagatacttcaaaaatgatagagataggagggatttgatcacgtgcggtgcagctgctggtgttgccgctgccttccgtgcccccgttggtggtgttctg |
201 |
Q |
| |
|
|||||| || |||||||| |||||| | |||||||||||||| || ||||| |||||||||||||| | ||||||||||||||| || |||||||| || |
|
|
| T |
56470981 |
cagatattttaaaaatgacagagatcgaagggatttgatcacatgtggtgcggctgctggtgttgctggtgccttccgtgccccagtcggtggtgtcctt |
56470882 |
T |
 |
| Q |
202 |
ttcgcactcgaagaggcagcttcatggt |
229 |
Q |
| |
|
|| ||||| ||||| |||||||| |||| |
|
|
| T |
56470881 |
tttgcacttgaagaagcagcttcttggt |
56470854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University