View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_high_84 (Length: 234)
Name: NF17152_high_84
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_high_84 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 52373772 - 52373977
Alignment:
| Q |
11 |
gagaagcaaaggatggaaaaagatttggatgaagggattctgaggagtgttggcgaaggaattaaagaaagtgttttgaagaaagagggtgtagaagttg |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52373772 |
gagatgcaaaggatggaaaaagatttggatgaagggattctgaggagtgttggcgaaggaattaaagaaagtgttttgaagaaagagggtgtagaagttg |
52373871 |
T |
 |
| Q |
111 |
gatgggttgttttggttaagagtgaatgtgttccgaaaactacttctgggaaattgcaaagatgggctgctaaagagaagcttcttgatggaaaaatgaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52373872 |
gatgggttgttttggttaagagtgaatgtgttccgaaaactacttctgggaaattgcaaagatgggctgctaaagagaagcttcttgatggaaaaatgaa |
52373971 |
T |
 |
| Q |
211 |
aatttt |
216 |
Q |
| |
|
|||||| |
|
|
| T |
52373972 |
aatttt |
52373977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University