View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17152_high_84 (Length: 234)

Name: NF17152_high_84
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17152_high_84
NF17152_high_84
[»] chr3 (1 HSPs)
chr3 (11-216)||(52373772-52373977)


Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 216
Target Start/End: Original strand, 52373772 - 52373977
Alignment:
11 gagaagcaaaggatggaaaaagatttggatgaagggattctgaggagtgttggcgaaggaattaaagaaagtgttttgaagaaagagggtgtagaagttg 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52373772 gagatgcaaaggatggaaaaagatttggatgaagggattctgaggagtgttggcgaaggaattaaagaaagtgttttgaagaaagagggtgtagaagttg 52373871  T
111 gatgggttgttttggttaagagtgaatgtgttccgaaaactacttctgggaaattgcaaagatgggctgctaaagagaagcttcttgatggaaaaatgaa 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
52373872 gatgggttgttttggttaagagtgaatgtgttccgaaaactacttctgggaaattgcaaagatgggctgctaaagagaagcttcttgatggaaaaatgaa 52373971  T
211 aatttt 216  Q
    ||||||    
52373972 aatttt 52373977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University