View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF17152_low_108 (Length: 206)
Name: NF17152_low_108
Description: NF17152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF17152_low_108 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 69 - 154
Target Start/End: Original strand, 34678933 - 34679018
Alignment:
| Q |
69 |
ttaaaatatcatctaaatctatgatataaataaaaagtagaaaacaatttgtgtgaacactagatatagatatagtcagtcccata |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34678933 |
ttaaaatatcatctaaatctatgatataaataaaaagtagaaaacaatttgtgtgaacactagatatagatatagtcagtcccata |
34679018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 23 - 78
Target Start/End: Original strand, 34678868 - 34678923
Alignment:
| Q |
23 |
ttattttaatcaacatcgtatatttcattatcatctatgaaccactttaaaatatc |
78 |
Q |
| |
|
||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34678868 |
ttatttttatcaacatcgtatatttcaatatcatctatgaaccactttaaaatatc |
34678923 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University